View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_27 (Length: 422)
Name: NF12023_low_27
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 109 - 415
Target Start/End: Complemental strand, 43537336 - 43537021
Alignment:
| Q |
109 |
aattagtggggtggcatggaggatggaaaaagtggattatggagaacgaaatcggaacaactagagtcagtgat------------gtccacaccgggat |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
43537336 |
aattagtgaggtggcatggaggatggaaaaagtggattatggagaacgaaatcggaacaactagagtcagtggtagaagatttgacgtccacaccgggat |
43537237 |
T |
|
| Q |
197 |
caagtgagtcggtcggagtggcggacggtggtagtgggagtcttacaagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537236 |
caagtgagtcggtcggagtggcggacggtggtagtgggagtcttactagaaaatcaaggagggcatcccccggtggaagaaatacacacataaggaaggc |
43537137 |
T |
|
| Q |
297 |
gaggagtgtccagacttctttgaaggttgatttggatcatgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttccttt |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43537136 |
gaggagtgtccagacttctttgaaggttgatttgg---atgaggttaatagtggtgctgctcttagtagagcttcaagtttgggactctcattttccttt |
43537040 |
T |
|
| Q |
397 |
actggattctctgctcctc |
415 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
43537039 |
actggattctctgttcctc |
43537021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 71
Target Start/End: Complemental strand, 43537403 - 43537374
Alignment:
| Q |
42 |
atcaagaagtaacataaaatacatgaaata |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43537403 |
atcaagaagtaacataaaatacatgaaata |
43537374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University