View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_28 (Length: 417)
Name: NF12023_low_28
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_28 |
 |  |
|
| [»] scaffold0604 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 5e-32; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 319 - 404
Target Start/End: Complemental strand, 6131523 - 6131437
Alignment:
| Q |
319 |
tctcttgtgtctattacacaaacacccctagatcaattcatccattcctttccc-tcgagttctacattgttccaccttctcgtatc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
6131523 |
tctcttgtgtctattacacaaacacccctagatcaattcattcattcctttcccttcgagttctacatcgttccaccttctcgtatc |
6131437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 316 - 404
Target Start/End: Original strand, 16695714 - 16695803
Alignment:
| Q |
316 |
ttctctcttgtgtctattacacaaacacccctagatcaattcatccattcctttccc-tcgagttctacattgttccaccttctcgtatc |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
16695714 |
ttctctcttgtgtctattacacaaacacccctagatcaattcattcattcctttccctttgagttctacatcgttccaccttctcgtatc |
16695803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 131 - 357
Target Start/End: Original strand, 16695444 - 16695660
Alignment:
| Q |
131 |
aatataaatgcgacacgtagctctattttgtcttttagcaacggccaaaatttcaacccatttcttgtttttacccctttccc--ttcagtaaaatggct |
228 |
Q |
| |
|
|||||||||||||||| | || |||||||||||||| |||||| ||||||||||||| ||||| || ||||||| |||| || |||||||||||||| |
|
|
| T |
16695444 |
aatataaatgcgacacatggcactattttgtctttttgcaacgttcaaaatttcaaccgatttcgtgcttttacctctttaccctttcagtaaaatggcc |
16695543 |
T |
 |
| Q |
229 |
agccaaaatactctctctattgcctattacacaaacacccctggatcaatttctctctcgtgggtcagtttaaaaaagttaaattttttctctcttgtgt |
328 |
Q |
| |
|
|| |||| | ||| ||||||||||||||| ||| |||||| ||||||| || ||||||||||||||| |||| |||||||| |||| |
|
|
| T |
16695544 |
agtcaaattg----------tgcgtattacacaaacacctctgtatcaatctctctcttgtaggtcagtttaaaaaaaataaaaaatttctctc--gtgt |
16695631 |
T |
 |
| Q |
329 |
ctattacacaaacacccctagatcaattc |
357 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
16695632 |
ctattacagaaacacccctagatcaattc |
16695660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 131 - 357
Target Start/End: Complemental strand, 6131795 - 6131579
Alignment:
| Q |
131 |
aatataaatgcgacacgtagctctattttgtcttttagcaacggccaaaatttcaacccatttcttgtttttacccctttccc--ttcagtaaaatggct |
228 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||||||||| || ||||||||||||||||||| || ||||||| |||| | ||| |||||||||| |
|
|
| T |
6131795 |
aatataaatgcgccacgtggcgctattttgtcttttagcaatggtcaaaatttcaacccatttcgtgcttttacctctttactctttcggtaaaatggcc |
6131696 |
T |
 |
| Q |
229 |
agccaaaatactctctctattgcctattacacaaacacccctggatcaatttctctctcgtgggtcagtttaaaaaagttaaattttttctctcttgtgt |
328 |
Q |
| |
|
|| |||| | || |||||| |||||||||||| ||||||||||||||||| ||||||||| ||||| |||| |||||||| |||| |
|
|
| T |
6131695 |
agtcaaattg----------tgtgtattacgcaaacacccctgtatcaatttctctctcgtaggtcagttttaaaaaaataaaaaatttctctc--gtgt |
6131608 |
T |
 |
| Q |
329 |
ctattacacaaacacccctagatcaattc |
357 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |
|
|
| T |
6131607 |
ctattacataaacacccctatatcaattc |
6131579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0604 (Bit Score: 67; Significance: 1e-29; HSPs: 3)
Name: scaffold0604
Description:
Target: scaffold0604; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 319 - 404
Target Start/End: Complemental strand, 1668 - 1582
Alignment:
| Q |
319 |
tctcttgtgtctattacacaaacacccctagatcaattcatccattcctttccc-tcgagttctacattgttccaccttctcgtatc |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
1668 |
tctcttgtgtctattacacaaacacccctagatcaattcattcattcatttcccttcgagttctacatcgttccaccttctcgtatc |
1582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0604; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 131 - 227
Target Start/End: Complemental strand, 1938 - 1840
Alignment:
| Q |
131 |
aatataaatgcgacacgtagctctattttgtcttttagcaacggccaaaatttcaacccatttcttgtttttaccccttt--cccttcagtaaaatggc |
227 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||||| ||||||| ||||||||||||||||||| | ||||||| |||| || |||||||||||||| |
|
|
| T |
1938 |
aatatacatgcgacacgtggcactattttgtctttttgcaacggtcaaaatttcaacccatttcgtccttttacctctttaccctttcagtaaaatggc |
1840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0604; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 253 - 305
Target Start/End: Complemental strand, 1824 - 1774
Alignment:
| Q |
253 |
tattacacaaacacccctggatcaatttctctctcgtgggtcagtttaaaaaa |
305 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
1824 |
tattacataaacacccctg--tcaatttctctctcgtaggtcagtttaaaaaa |
1774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University