View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_33 (Length: 392)
Name: NF12023_low_33
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 164 - 382
Target Start/End: Original strand, 47283422 - 47283638
Alignment:
| Q |
164 |
tggttaagatttggttgtagttgacccaacctagtggataaaagttggtattttttaaagaatatttgtctgtgcttgtaaaacagtagagaccattaaa |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47283422 |
tggttaagatttggttgtagttgacccaacctagtggataaaagttggtattttttaaagaatatttgtctgtgcttgtaaaacagtagagaccattaaa |
47283521 |
T |
|
| Q |
264 |
tttattgtttcctttctgttttgtgtttaggtttgttatatttgaagtctttcttccgacattttgcatctctacttatatatatgactatttttctcgc |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
47283522 |
tttattgtttcctttctgttttgtgtttaggttagttatatttgaagtctttcttccgacattttgcatctctact--tatacatgactatttttctcgc |
47283619 |
T |
|
| Q |
364 |
agagtagctcagtcctatg |
382 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
47283620 |
agagtagctcagtcctatg |
47283638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 17 - 166
Target Start/End: Original strand, 47283229 - 47283378
Alignment:
| Q |
17 |
agctttctggatgtgatccaacggtagttgcttctaactattggtcatcacgaagccaagtgctttgccgtacaagttggggacagtttgcagaaggatc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47283229 |
agctttctggatgtgatccaacggtagttgcttctaactattggtcatcacgaagccaagtgctctgccgtacaagttggggacagtttgcagaaggatc |
47283328 |
T |
|
| Q |
117 |
aatatccatgaaaatgttccttgtgttgtaagcgggtgatatttatatgg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47283329 |
aatatccatgaaaatgttccttgtgttgtaagctggtgatatttatatgg |
47283378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University