View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_low_40 (Length: 361)

Name: NF12023_low_40
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_low_40
NF12023_low_40
[»] chr7 (2 HSPs)
chr7 (131-295)||(37956125-37956288)
chr7 (14-74)||(37956345-37956405)
[»] scaffold1949 (1 HSPs)
scaffold1949 (18-60)||(113-155)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 131 - 295
Target Start/End: Complemental strand, 37956288 - 37956125
Alignment:
131 caaatttgtacaatatttgattcatgtaaatacaaatagtttttgaacttataattgagtttgaattagtgtggttttgccaacaaaattttttaggata 230  Q
    |||||||||||||||||||| |||| |||| ||||| | ||| || |||| ||||| ||||| ||||||| || |||| |||||||||  ||||||||||    
37956288 caaatttgtacaatatttgagtcatataaacacaaacattttgtgtacttctaattaagttttaattagtttgatttt-ccaacaaaagcttttaggata 37956190  T
231 ttatagaccacaaattatctacaaacggtaatttcttcagacaaatttcgtagtttgattatttc 295  Q
     |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
37956189 atatagaccacaaattatctacaaacggtaacttcttcagacaaatttcgtagtttgattatttc 37956125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 14 - 74
Target Start/End: Complemental strand, 37956405 - 37956345
Alignment:
14 gaacagtataaagttaaaatataatgatggattgagatgcaaatatatggagattgagatg 74  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37956405 gaacaatataaagttaaaatataatgatggattgagatgcaaatatatggagattgagatg 37956345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1949 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold1949
Description:

Target: scaffold1949; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 155 - 113
Alignment:
18 agtataaagttaaaatataatgatggattgagatgcaaatata 60  Q
    ||||||||||||||||||||  |||||||||||| ||||||||    
155 agtataaagttaaaatataacaatggattgagattcaaatata 113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University