View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_43 (Length: 352)
Name: NF12023_low_43
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 19 - 339
Target Start/End: Original strand, 7939992 - 7940310
Alignment:
| Q |
19 |
actatgtttaatgtgcacacattgcaaattgttgaaggggaaaattctcttatgttattgcaatttgcaacaagaaaattccaacagttttaagcttatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7939992 |
actatgtttaatgtgcacacattgcaaattgttgaaggagaaaattctcttatgttattgcaatttgcaacaagaaaattccaacagttttaagcttatt |
7940091 |
T |
 |
| Q |
119 |
gttgaaggagaaaattccaacaagaaaattccaactattgcaatgtgcacacattgcaaattgatagaaggagaaaattctcttatgcacacaaaaactc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7940092 |
gttgaaggagaaaattccaacaagaaaattccaactattgcaatgtgcacacattgcaaattgatagaaggagaaaattctcttatgcacacaaaaactc |
7940191 |
T |
 |
| Q |
219 |
atataattttttcgtaaactaagagcccgtttggttaatatgataacattattttgacctatcatatgattggtacactcatcaatttatcctatcttct |
318 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
7940192 |
--ataattttttcgtaaactaagagcctgtttggttaatatgataacattattttatcctatcatatgattggtacattcatcaatttaccctatcttct |
7940289 |
T |
 |
| Q |
319 |
tttgcccatttgctagtctct |
339 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7940290 |
tttgcccatttgctagtctct |
7940310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University