View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_74 (Length: 260)
Name: NF12023_low_74
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_74 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 30882381 - 30882274
Alignment:
| Q |
1 |
ttaaaattgtggatttttggctttctgccatcgatgacactaattaaaacaacaaaaacaatagtttcacttggtaaggttagctacaagatcaaacaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30882381 |
ttaaaattgtggatttttggctttctgccatcgatgacactaattaaaacaacaaaaacaatagtttcacttggtaaggttagctacaagatcaaacaat |
30882282 |
T |
|
| Q |
101 |
gtcaaata |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
30882281 |
gtcaaata |
30882274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 160 - 228
Target Start/End: Complemental strand, 872035 - 871966
Alignment:
| Q |
160 |
acaactctttttgtacc-tgtttgatttagaaattggccatggaactggacaaaacgtgtaacaaaggac |
228 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| ||||| ||| |||||||| ||| |||||||| |
|
|
| T |
872035 |
acaactttttttgtaccctgtttgatttagaaattggacatgggactagacaaaacaggtagcaaaggac |
871966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 214
Target Start/End: Original strand, 32327815 - 32327903
Alignment:
| Q |
127 |
tttgatctgctaaaaaacaagggcctgaactaaacaactctttttgtac-ctgtttgatttagaaattggccatggaactggacaaaac |
214 |
Q |
| |
|
|||||| |||||||||| | ||| ||| ||| ||||||| ||||||||| | |||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
32327815 |
tttgatttgctaaaaaataggggactgtactgaacaactttttttgtactcagtttgatttagaaactggtcatgagactggacaaaac |
32327903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 29614884 - 29614932
Alignment:
| Q |
166 |
ctttttgtacc-tgtttgatttagaaattggccatggaactggacaaaa |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
29614884 |
ctttttgtaccctgtttgatttagaaattggtcatggaattggacaaaa |
29614932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University