View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_75 (Length: 258)
Name: NF12023_low_75
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 253
Target Start/End: Complemental strand, 46541864 - 46541629
Alignment:
| Q |
18 |
atgaaagggatttgaaagaagaaccaagtttgtaagttgagggggacctgtgtatggtgccaatgccatcagtggtgacttgtagcggatgttagtgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46541864 |
atgaaagggatttgaaagaagaaccaagtttgtaagttgagggggacctgtgtatggtgccaatgccatcagtggtgacttgtagcggatgttagtgaat |
46541765 |
T |
 |
| Q |
118 |
gggggctttcttttgccagtttttcacttttaccatatttgatacaaacaacactgacaacagtatagcttgccaaagcaattctgtaactctgtttcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46541764 |
gggggctttcttttgccagtttttcacttttaccatatttgatacaaacaacactgacaacagtatagcttgccaaagcaattctgtaactctgtttcac |
46541665 |
T |
 |
| Q |
218 |
cccctcgtgtgtgtactgcaattttttcttctctct |
253 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46541664 |
cccctcgtgtgtgtattgcaattttttcttctctct |
46541629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University