View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_77 (Length: 257)
Name: NF12023_low_77
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_77 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 42797616 - 42797791
Alignment:
| Q |
1 |
gtgagcctgcaaatagagaaagaaaatgtattccaacgaattggtaaaattgaacaaggatattgaactatcaaaaacttctttggaagataagatgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42797616 |
gtgagcctgcaaatagagaaagaaaatgtattccaacgaattggtagaattg-------------aactatcaaaaacttctttggaagataagatgtgt |
42797702 |
T |
|
| Q |
101 |
catttagaagcagttttatctaaccttcaccaaaatattcaatccatttccctatacatattaaaacaacgtaacttccaaaataatta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42797703 |
catttagaagcagttttatctaaccttcaccaaaatattcaatccatttccctatacatattaaaacaacgtaacttccaaaataatta |
42797791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 183 - 238
Target Start/End: Original strand, 42798152 - 42798207
Alignment:
| Q |
183 |
ataattattatcaactatatgctaaatcaagaaaccgtttgataatatgagttgtg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42798152 |
ataattattatcaactatatgctaaatcaagaaaccatttgataatatgagttgtg |
42798207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University