View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_78 (Length: 255)
Name: NF12023_low_78
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_78 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 28 - 98
Target Start/End: Complemental strand, 392576 - 392510
Alignment:
| Q |
28 |
tgttatttctttatggttaattaagttgtgttcactttccatcagccttacagaaatgatgttgtagggta |
98 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
392576 |
tgttatttctttatggttaa----gttgtattcactttccatcagccttacagaaatgatgttgtagggta |
392510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 137 - 215
Target Start/End: Original strand, 5948005 - 5948088
Alignment:
| Q |
137 |
tttgttatttttcaggctcaaaagcaaaagtagaat-----gacatacttagatgtgtaaccctagctgttggcatggttaaat |
215 |
Q |
| |
|
||||||||||||||||| ||||| ||||| || ||| |||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
5948005 |
tttgttatttttcaggcccaaaaacaaaaatacaataatctgacatacttagatgcgtaaccctggctgttggcatggttaaat |
5948088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University