View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_82 (Length: 250)
Name: NF12023_low_82
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_82 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 60 - 239
Target Start/End: Complemental strand, 9930767 - 9930585
Alignment:
| Q |
60 |
ttatgatcatgtttccaagatcatagatgttattgttaacttgagttaaacattggagcacgagtctttgaggtcaaagtgctagtttcatgtgccttca |
159 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| | ||||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9930767 |
ttatgatcatgtttccaagatcatagacgttatcgataacttgagttaaacattgaagcacgggtctttgaggtcaaagtgctagtttcacgtgccttca |
9930668 |
T |
|
| Q |
160 |
atcaattctggcatccctacgactttcgagagactcttcggtcctg---agaaagattttaccatcgatgttcgaccatctct |
239 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
9930667 |
accaattctggcatccctacgactttcgagagactcttcggtcctgatcagaaagattttaccatcggtgttcgaccatctct |
9930585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 9930823 - 9930784
Alignment:
| Q |
1 |
ctatttcatggtgttttgtggtaaccagtccacacaacac |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9930823 |
ctatttcatggtgttttgtggtaaccagtccacacaacac |
9930784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University