View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_94 (Length: 240)
Name: NF12023_low_94
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_94 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 103 - 225
Target Start/End: Original strand, 2175602 - 2175724
Alignment:
| Q |
103 |
taacaagtcaaaatgagatatataaacaaacagatctactacctaacataagatttgaatcatatacgttatcttttgttgattaactttattttatata |
202 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
2175602 |
taacaagtcaaaatgaaatatataaacaaacagatctactatctaacataagatttgaatcatatacgttaccttttgttgattaactttcttttatata |
2175701 |
T |
|
| Q |
203 |
taaaacgagagaagtatgaagat |
225 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
2175702 |
tagaacgagagaagtatgaagat |
2175724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 2175074 - 2175122
Alignment:
| Q |
8 |
tacaccctttcgatgaaaaataaataaatacatcgaaatggttaaccaa |
56 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2175074 |
tacaccctttggatgaaaaataaataaatacatccaaatggttaaccaa |
2175122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University