View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_96 (Length: 239)
Name: NF12023_low_96
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_96 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 35 - 224
Target Start/End: Original strand, 11182151 - 11182339
Alignment:
| Q |
35 |
gtgaatatcgtgagaatcctaatttttattttgtggatttttggaagcgagtacagaaaatgaaaatgcaagtatagaaaaatttaaatctaagacttgt |
134 |
Q |
| |
|
||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11182151 |
gtgaaaattgtgagaaccctaatttttattttgtggatttttggaagcgagtacagaaaatgaaaatgcaagtatagaaaaatttaaatc-aagacttgt |
11182249 |
T |
 |
| Q |
135 |
tgcacaaggcttcaatcatacagaaggattgaactactttgagagattcccacttaatgcaaagtaatccatagtgagagctgttctttt |
224 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||| |
|
|
| T |
11182250 |
tgcacaagggttcaatcatacagaaggattgaactactttgagagattcccacttaatgcaaagttatccatagtaagaactgttctttt |
11182339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University