View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12023_low_96 (Length: 239)

Name: NF12023_low_96
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12023_low_96
NF12023_low_96
[»] chr5 (1 HSPs)
chr5 (35-224)||(11182151-11182339)


Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 35 - 224
Target Start/End: Original strand, 11182151 - 11182339
Alignment:
35 gtgaatatcgtgagaatcctaatttttattttgtggatttttggaagcgagtacagaaaatgaaaatgcaagtatagaaaaatttaaatctaagacttgt 134  Q
    ||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
11182151 gtgaaaattgtgagaaccctaatttttattttgtggatttttggaagcgagtacagaaaatgaaaatgcaagtatagaaaaatttaaatc-aagacttgt 11182249  T
135 tgcacaaggcttcaatcatacagaaggattgaactactttgagagattcccacttaatgcaaagtaatccatagtgagagctgttctttt 224  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||||||    
11182250 tgcacaagggttcaatcatacagaaggattgaactactttgagagattcccacttaatgcaaagttatccatagtaagaactgttctttt 11182339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University