View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12023_low_97 (Length: 239)
Name: NF12023_low_97
Description: NF12023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12023_low_97 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 41469203 - 41469002
Alignment:
| Q |
1 |
tcatcttcatatcataaacattgtgatttcgaataataattagagtttgtgtacgatggattagcttttctttctttatttcaagtattccattgataga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41469203 |
tcatcttcatatcataaacattgtgatttcgaataataattagagtttgtgtacgatggattagcttttctttctttatttcaagtattccattgataga |
41469104 |
T |
|
| Q |
101 |
cccctaaagtattgctaagtttcctttatattagtagcctttacaggtacgcgttttatgatcttgttacttaatggatagtttggagcttgacaagtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41469103 |
cccctaaagtattgctaagtttcctttatat---tagcctttacaggtacgcattttatgatcttgttacttaatggatagtttggagcttgacaagtct |
41469007 |
T |
|
| Q |
201 |
aacaa |
205 |
Q |
| |
|
||||| |
|
|
| T |
41469006 |
aacaa |
41469002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University