View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12026_high_9 (Length: 355)
Name: NF12026_high_9
Description: NF12026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12026_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 11 - 341
Target Start/End: Complemental strand, 52151336 - 52151007
Alignment:
| Q |
11 |
cataggtccacttatgtcttgttttgataatctgagggtacacaacattttcatagcaggaactagagtttggactttggaataagactctaatcggtca |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52151336 |
cataggtccacttatgtcttgttttgataatctcagggtacacaacattttcatagcaggaactagagtttggactttggaataagactctaatcggtca |
52151237 |
T |
 |
| Q |
111 |
attctgttgatgggaaatggaaaatagctcgatctgcgggcaagggcgtggggacgcacgagcccgtggaggatgagaagttggctaacccataagttgg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52151236 |
attctgttgatgggaaatggaaaatagcttgatctgcgggcaagggcgtggggacgcacgagcccgtggaggatgagaagttggctaacccataagttgg |
52151137 |
T |
 |
| Q |
211 |
ttggctgaaatgcaatatgtatgcagccttctctcaccaaagcaagatgaccgagattgagatatgtttcaaaaatagttttggctattctgttcggtcc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52151136 |
ctggctgaaatgcaatatgtatgcagccttctctcaccaaagcaagatgactgagattgagatatgtttcaaaaatagttttggctattctgttcggtcc |
52151037 |
T |
 |
| Q |
311 |
ttagcagggggcctgttgagagttgcttctg |
341 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
52151036 |
ttagca-ggggcctgttgagagttgcttctg |
52151007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University