View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12026_low_13 (Length: 248)
Name: NF12026_low_13
Description: NF12026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12026_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 6019298 - 6019058
Alignment:
| Q |
1 |
tattccataacaaaatttatgattttattgacgtacttgtaccnnnnnnnnaatgttgtcgtattctggaaccagtactcgtatcgtaccagataccata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6019298 |
tattccataacaaaatttatgattttattgacgtacttgtaccttttttttaatgttgtcgtattttggaaccagtactcgtatcgtaccagataccata |
6019199 |
T |
 |
| Q |
101 |
cccgttcctatgcatcatagttgcaaactttcaagtgacattttacctgatattgacaattgcttcgttttggatctaagctataaaatagaaaattagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6019198 |
cccgttcctatgcatcatagttgcaaactttcaagtgacattttacctgatattgacaattgcttcgttttggatctaagctataaaatagaaaattagt |
6019099 |
T |
 |
| Q |
201 |
gacgacgaagaaactaatttaccatatagctcatatctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6019098 |
gacgacgaagaaactaatttaccatatagctcatatctctg |
6019058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 122
Target Start/End: Original strand, 408383 - 408445
Alignment:
| Q |
60 |
cgtattctggaaccagtactcgtatcgtaccagataccatacccgttcctatgcatcatagtt |
122 |
Q |
| |
|
|||||||| | |||||||| |||||||||||| |||| ||||||| |||||||| ||||||| |
|
|
| T |
408383 |
cgtattctcgtaccagtacctgtatcgtaccaggtaccgtacccgtgcctatgcaacatagtt |
408445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University