View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12026_low_16 (Length: 238)
Name: NF12026_low_16
Description: NF12026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12026_low_16 |
 | |
|
| [»] scaffold0300 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0300 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: scaffold0300
Description:
Target: scaffold0300; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 3769 - 3976
Alignment:
| Q |
16 |
agacaccagatcaatctctaaaatgaaaatatcttaaaagaaacacaaattttgcggaacttcaacgagaatgtgagaatgaatttcgattttgttacct |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3769 |
agacaccagatcaatctctaaaatgaacatatcttaagagaaacacaaattttgcggaacttcaacgagaatgtgagaatgaatttcgattttgttacct |
3868 |
T |
|
| Q |
116 |
tcaattttgacggtcttcaattatgaaccggttaaagatgttccatgattaaggatttagggttcttactcttccaagcttcaatgatttggtcttccct |
215 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3869 |
tcgattttgacggtcttcagttatgaaccggttaaggatgttcgatgattggggatttagggttcttactcttccaagcttcaacgatttggtcttccct |
3968 |
T |
|
| Q |
216 |
tgtaactg |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
3969 |
tgtaactg |
3976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University