View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12026_low_18 (Length: 221)
Name: NF12026_low_18
Description: NF12026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12026_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 8882590 - 8882785
Alignment:
| Q |
1 |
ccctgtttggaagtatagaaagaaccactgaaagtctgaaacaacttagggtttactggacttgtttgcactacaaaatttattgtaggaccatatggca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8882590 |
ccctgtttggaagtatagaaaaaaccactgaaagtctgaaacaacttagggtttactggacttgtttgcactacaaaatttattgtaggaccatatggca |
8882689 |
T |
|
| Q |
101 |
acagattagaacactaacaggaaacgaaaatacaatgaccatatatacaatcaaaatatttgcccaatcaaaagaataatcaaatgcttacagttcccaa |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8882690 |
acagattagaacactaacaggaaacaaaaatacaatgacc----atacaatcaaaatatttgcccaatcaaaagaataatcaaatgcttacaggtcccaa |
8882785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University