View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12027_high_7 (Length: 377)
Name: NF12027_high_7
Description: NF12027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12027_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 51 - 142
Target Start/End: Original strand, 49237479 - 49237570
Alignment:
| Q |
51 |
ggggccgggtcatttgacggaaatggaaggcttttcccctattagagaaggccctctgaagtcaaggggaagtgcattaattcttggaaaaa |
142 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49237479 |
ggggccgggtcatttcacggaaatggaaggcttttcctctattagagaaggccctctgaagtcaaggggaactgcattaattcttggaaaaa |
49237570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 283 - 361
Target Start/End: Complemental strand, 34610303 - 34610225
Alignment:
| Q |
283 |
gggctgggccacctcgaatggcgtgagccgcatgcggggagacccgcacgtacggtttttagggggatctggtcgaaag |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
34610303 |
gggctgggccacctcgaatggcgtgagccgcatgcggggagacccgcacgtacggtttttagggagatctggtcaaaag |
34610225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University