View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12027_high_9 (Length: 246)
Name: NF12027_high_9
Description: NF12027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12027_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 120 - 235
Target Start/End: Complemental strand, 289287 - 289172
Alignment:
| Q |
120 |
caatatcatgtcgttgcattttaatggatttaaacccgctaccggtcccaactaatcagaatgaaatattttataagcaaagccatgccatcattgtcat |
219 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
289287 |
caataccatgtcgttgcattttaatggatttaaacccgtcactgctcccaactaatcagaatgaaatattttataagcaaagccatgccattattgtcat |
289188 |
T |
|
| Q |
220 |
tacactttatctctct |
235 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
289187 |
tacactttatctctct |
289172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University