View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12027_low_6 (Length: 408)
Name: NF12027_low_6
Description: NF12027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12027_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 25 - 235
Target Start/End: Complemental strand, 32561921 - 32561715
Alignment:
| Q |
25 |
atgaccaatgtatatatgattggctttgtgattcaaaaacttgtgatcaaatgttgttcaacgtctttctttattttattgacaaaatacgtgatttaca |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32561921 |
atgaccaatgtatatatgattggctttgtgattcaaaagcttgtgatcaaatgttgttcaacgtctttctttattttattgacaaaatacgtgatttaca |
32561822 |
T |
 |
| Q |
125 |
cctcaaaatttcnnnnnnnnnnnnnntataattgttcagttacctagctgatataactaaaataagaaattgaaaaagaaagtcaatattctcagttatt |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
32561821 |
cctcaaaatttc--aaaaaataaaaatataattgttcagttacctagctgatataactaaaataagaaatcgaaaaagaaagtcaatat--tcagttatt |
32561726 |
T |
 |
| Q |
225 |
tgatggacaat |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
32561725 |
tgatggacaat |
32561715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 364 - 394
Target Start/End: Complemental strand, 32561617 - 32561587
Alignment:
| Q |
364 |
gttttggtcgttgttatggctcatctatctt |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32561617 |
gttttggtcgttgttatggctcatctatctt |
32561587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 339
Target Start/End: Complemental strand, 32561654 - 32561613
Alignment:
| Q |
298 |
agtggtaataccatctccctgtttctgttgcttaatcgtttt |
339 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||| ||||| |
|
|
| T |
32561654 |
agtggtaataccatctccctatttctgttacttaatggtttt |
32561613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University