View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_high_18 (Length: 433)
Name: NF12029_high_18
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 306; Significance: 1e-172; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 418
Target Start/End: Complemental strand, 48085532 - 48085153
Alignment:
| Q |
19 |
agacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaaaccactagctatggaatacaaaacaaaagattaatggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085532 |
agacattttattactgacaatttgagtgggaaaaccagtactcaagaacttggcatgacaaaccactagctatggaatacaaaacaaaag---------- |
48085443 |
T |
 |
| Q |
119 |
aaattaaagggacacagataaagaaaatacacacataaactaacnnnnnnncattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085442 |
----------gacacagataaagaaaatacacacataaactaacaaaaaaacattaaccaaatgtcttggatggattgatcaagtcctggaatctaaggc |
48085353 |
T |
 |
| Q |
219 |
catgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggatttggttgactatgattttgtttgccttttcagatggatggaatgca |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085352 |
catgatagtgctgagattcatgggatacatgtactgagcactgcccctaaggattcggttgactatgattttgtttgccttttcagatggatggaatgca |
48085253 |
T |
 |
| Q |
319 |
tcccaaaatgcattaagttctctgtttgggcacaagtttgaggctggtgtacaaagcccaagtccattgtatggcccttgtccacagcatgctacctttg |
418 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085252 |
tcccaaaaagcattaagttctctgtttgggcacaagtttgaggctggtgtacaaagcccaagtccattgtatggcccttgtccacagcatgctacctttg |
48085153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 286 - 331
Target Start/End: Complemental strand, 48102536 - 48102491
Alignment:
| Q |
286 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48102536 |
attttgtttgccttttcagatggatggaatgcatcccaaaatgcat |
48102491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 292 - 356
Target Start/End: Complemental strand, 1809590 - 1809526
Alignment:
| Q |
292 |
tttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtt |
356 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||| | |||||||| ||||||||||| |
|
|
| T |
1809590 |
tttgccttttcagatggatggaatggatcccaaaatacatacaagtctctgttagggcacaagtt |
1809526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 289 - 356
Target Start/End: Original strand, 7385568 - 7385635
Alignment:
| Q |
289 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||| |||| ||||||||| |
|
|
| T |
7385568 |
ttgtttgccttttcagatggatggaatgcatcccaaaatgcatttaagtctctatttgagcacaagtt |
7385635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 280 - 418
Target Start/End: Original strand, 35376267 - 35376405
Alignment:
| Q |
280 |
actatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttgaggctggtgtacaaagcccaa |
379 |
Q |
| |
|
||||||||| || | || ||||||||||||||||||| |||||||||||||| ||| |||| ||| ||||||||||||| ||||| || || |||| |
|
|
| T |
35376267 |
actatgattctgctagctttttcagatggatggaatggatcccaaaatgcataaaggtctcgattttggcacaagtttgaaaggggtgtgcatagtccaa |
35376366 |
T |
 |
| Q |
380 |
gtccattgtatggcccttgtccacagcatgctacctttg |
418 |
Q |
| |
|
|||||||| || ||||||||||| || |||| ||||| |
|
|
| T |
35376367 |
tcccattgtaagggccttgtccacaacaagctatctttg |
35376405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 279 - 359
Target Start/End: Original strand, 35357711 - 35357791
Alignment:
| Q |
279 |
gactatgattttgtttgccttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttga |
359 |
Q |
| |
|
|||||||||| || | || |||||||||||||| ||||||||||||||||||| ||| | || ||||||||||| ||||| |
|
|
| T |
35357711 |
gactatgattctgctagctttttcagatggatgaaatgcatcccaaaatgcataaaggtttcgatttgggcacaattttga |
35357791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 298 - 358
Target Start/End: Original strand, 35364521 - 35364581
Alignment:
| Q |
298 |
ttttcagatggatggaatgcatcccaaaatgcattaagttctctgtttgggcacaagtttg |
358 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| || |||| ||| |||||||||||| |
|
|
| T |
35364521 |
ttttcagatggatggattgaatcccaaaatgcatagaggtctcgattttggcacaagtttg |
35364581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 319 - 411
Target Start/End: Original strand, 6339168 - 6339260
Alignment:
| Q |
319 |
tcccaaaatgcattaagttctctgtttgggcacaagtttgaggctggtgtacaaagcccaagtccattgtatggcccttgtccacagcatgct |
411 |
Q |
| |
|
||||||||||||| ||| || || || ||||||||||| || ||||| ||||| || |||| ||||||| |||| ||||| ||||| |||||| |
|
|
| T |
6339168 |
tcccaaaatgcataaagatccctattagggcacaagttagaagctggagtacatagtccaactccattgaatggtccttgaccacaacatgct |
6339260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University