View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_high_36 (Length: 249)
Name: NF12029_high_36
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_high_36 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 14 - 249
Target Start/End: Original strand, 31512788 - 31513023
Alignment:
| Q |
14 |
ggccaaagagagtagtagaagagcttgaaaaacggtaactcttcctttgcagccatattgcgacaacaaggctgcaataaatatagttcataatccaaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31512788 |
ggccaaagagagtagtagaagagcttgaaaaacggtaactcttcctttgcagccatattgcgacaacaaggctgcaataaatatagttcataatccaaac |
31512887 |
T |
 |
| Q |
114 |
tttgcagccatattgaagagagagtggtattcattccatttgttccaaccacccaacagattgtagatggtctaaccaagggccaactgtttgaacacca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31512888 |
tttgcagccatattgaagagagagtggtatgcattccatttgttccaaccacccaacagattgtagatggtctaaccaagggccaactgtttgaacacca |
31512987 |
T |
 |
| Q |
214 |
agttaccaagttgggtatgatacatatgtttacacc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31512988 |
agttaccaagttgggtatgatacatatgtttacacc |
31513023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University