View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_low_15 (Length: 457)
Name: NF12029_low_15
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 24 - 438
Target Start/End: Complemental strand, 29009272 - 29008858
Alignment:
| Q |
24 |
cttcttcttcattgctctgagatttcactttctgaatttgcaggtacataaccaaattctctgttctgaattcataacaaactcttcaaccgcgcaaaga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009272 |
cttcttcttcattgctctgagatttcactttctgaatttgcaggtacataaccacattctctgttctgaattcataacaaactcttcaaccgcgcaaaga |
29009173 |
T |
 |
| Q |
124 |
tcatatatgttcgcttcaacttcttgattaaattcttcaaattccgattctggtttcattttattcaaattcaccttcacatttctatataatttgcatt |
223 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29009172 |
tcatataggttcgcttcaacttcttgattacattcttcaaattccgattctggtttcattttattcaaattcaccttcacatttctatataatttgcatt |
29009073 |
T |
 |
| Q |
224 |
tgcacgctactattttcactgaaactaattcttcaatttcatttgacactgttacggtgttatattcattcaattagatgaagaatttgaatcgaagcta |
323 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29009072 |
tgcacgctacaattttcactgaaactaattcttcaattgcatttgatactgttacggtgttgtattcattcgattagatgaagaatttgaatcgaagcta |
29008973 |
T |
 |
| Q |
324 |
tagttaactctgtgnnnnnnnnnnnnnnnnnnnnnnnntaggaaaatgaggccagtctgggcagtgaaagctatgttcgtggtcgtcttggcttcaattc |
423 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29008972 |
tagttaactctgtgtttttgattttttggtttgatttgtaggaaaatgaggccagtctgggcagtgaaagctatgttcgtggtcgtcttggcttcgattc |
29008873 |
T |
 |
| Q |
424 |
tcttccgttgcgttt |
438 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29008872 |
tcttccgttgcgttt |
29008858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University