View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_low_20 (Length: 408)
Name: NF12029_low_20
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 153 - 402
Target Start/End: Original strand, 39933642 - 39933896
Alignment:
| Q |
153 |
gaccatgctgtgttatatttcttctacggatattgttacttgagaattgttttatggaccccctaattcctcataagcccccaaaagat-----nnnnnn |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933642 |
gaccatgctgtgttatatttcttctacggatattgttacttgagaattgttttatggaccccctaattcctcataagcccccaaaagataaaaaaaaaaa |
39933741 |
T |
|
| Q |
248 |
ntacccttataaggaaattgctctttaggcacctagnnnnnnnnctgaacggtggttaattaccgttcagtaggacacgcgagaaacatatagtgtgata |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||| |||||||||||||| |||| |
|
|
| T |
39933742 |
atacccttataaggaaattgctctttaggcacttagtaaaaaaactgaacggtggttaattaccattcagtaggacacgcaagaaacatatagtgagata |
39933841 |
T |
|
| Q |
348 |
aaagtaagatcgtccatannnnnnnagcctagcctgttatatgtctatttgttgg |
402 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
39933842 |
aaagtatgatcgtccatatttttttagcctagcctgctatatgtctatttgttgg |
39933896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 39933506 - 39933578
Alignment:
| Q |
17 |
catcgtttatgtatagtttctgttgttaccaacacttcactattctgatcaattgaattgaaacagttgtaaa |
89 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39933506 |
catcttttatgtatagtttctgttgttaccaacacttcactattctgatcaattgaattgaaacagttgtaaa |
39933578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University