View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_low_32 (Length: 293)
Name: NF12029_low_32
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_low_32 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 10 - 293
Target Start/End: Original strand, 48824027 - 48824313
Alignment:
| Q |
10 |
acatcaattttataaggcattaattacttgttttatcaattatcacttcaaaatgaggatatcatacagtgccatgtagcataaggaaaataagatctct |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48824027 |
acatcaattttataaggtattaattacttgttttatcaattatcacttcaaaatgaggatatcatacagtgccatgtagcataaggaaaataagatctct |
48824126 |
T |
 |
| Q |
110 |
tttctaatgctgcataattcatagtgaagttgtcttgattttgctagtttttgagcaagcaagaagttgtgaattttctcctcgaccttttgtggtttgc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48824127 |
tttctaatgctgcataattcatagtgaagttgtcttgattttgctagtttttgagcaagcaagaagttgtgaattttctcctcgaccttttgtggtttgc |
48824226 |
T |
 |
| Q |
210 |
actgaatgaaaggaacaaacaaatatgtacttg---nnnnnnnnttcaatgcagactctgagtaagaatatatgatgcaaagagaac |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48824227 |
actgaatgaaaggaacaaacaaatatgtacttgaaaaaaaaaaaatcaatgcagactctgagtgagaatatatgatgcaaagagaac |
48824313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University