View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_low_34 (Length: 280)
Name: NF12029_low_34
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 15 - 144
Target Start/End: Complemental strand, 1632291 - 1632162
Alignment:
| Q |
15 |
ggtggggtgcagccaccgacaataggtaatgtgatgtccaatgtttctacagtgggtgcaaaatgccggcaatctttcataaataatttcgattgaaaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1632291 |
ggtggggtgcagccaccgacaataggtaatgtgatgtccaatgtttctacagtgggtgcaaaatgccggcaatctttcataaataatttcgattgaaaaa |
1632192 |
T |
|
| Q |
115 |
gaaaaaccttacatctcaatcattacctca |
144 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |
|
|
| T |
1632191 |
gaaaaaccttccctctcaatcattacctca |
1632162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 26593429 - 26593502
Alignment:
| Q |
46 |
tgatgtccaatgtttctacagtgggtgcaaaatgccggcaatctttcataaataatttcgattgaaaaagaaaa |
119 |
Q |
| |
|
|||||||||||||| | |||||| |||||||| |||||||| | |||||| |||| || |||||||||||||| |
|
|
| T |
26593429 |
tgatgtccaatgttcccacagtgtgtgcaaaacgccggcaaacgttcataggtaatctcaattgaaaaagaaaa |
26593502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 17150430 - 17150364
Alignment:
| Q |
19 |
gggtgcagccaccgacaataggtaatgtgatgtccaatgtttctacagtgggtgcaaaatgccggca |
85 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
17150430 |
gggtgcagccatcgacaacttgtaatatgatgtccaatgttcttacagtgagtgcaaaatgacggca |
17150364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University