View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12029_low_43 (Length: 239)
Name: NF12029_low_43
Description: NF12029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12029_low_43 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0018 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 68685 - 68463
Alignment:
| Q |
17 |
aatttagaatctgaatagcgtaaccatctaaacgaggcacgggagcagatggcatttgttcccaattccattgaggagcaggtaaatctgcaaaggtagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
68685 |
aatttagaatctgaatagcgtaaccatctaaacgaggcacaggagcagatggcatctgttcccaattccattgaggagcaggtaaatctgcaaaggtagc |
68586 |
T |
|
| Q |
117 |
agaaagaaaccttttcacctcaagaggaggttgtggtggtgttatagtggtggtgttggggttatcgacgatccaattggaagcgattgaaagagaagta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
68585 |
agaaagaaaccttttcacctcaagaggaggttgtggtggtgttatagtggtggtgttggggttatcgacgatccaattggaagcgattgaaagagaagta |
68486 |
T |
|
| Q |
217 |
gaagaataagaatggaagatggt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
68485 |
gaagaataagaatggaagatggt |
68463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University