View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_high_45 (Length: 271)
Name: NF1202_high_45
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_high_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 49 - 242
Target Start/End: Complemental strand, 40436830 - 40436637
Alignment:
| Q |
49 |
ataaagggatactggttgattcaaatgagacacaatgaaaaagaaccaattatatctaatgaaagttgaatcatatgatgattgtatggatgcactactg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40436830 |
ataaagggatactggttgattcaaatgagacacaatgaaaaagaaccaattatatctaatgaaagttgaatcatatgatgattgtatggatgcactactg |
40436731 |
T |
 |
| Q |
149 |
gatgcaaagcttacatgactaaactaggcttgtaaatagtgtattttatatatacggctatatacaaccccaaataaaaagcaatcacctatgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
40436730 |
gatgcaaagcttacatgactaaactaggcttgtaaatagtgtattttatatatacggctatatacaaccccaaataaaaagcaaccatctatgc |
40436637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University