View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1202_low_36 (Length: 360)

Name: NF1202_low_36
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1202_low_36
NF1202_low_36
[»] chr5 (1 HSPs)
chr5 (85-266)||(6203944-6204125)


Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 85 - 266
Target Start/End: Original strand, 6203944 - 6204125
Alignment:
85 atagggttttcgagtcggatttgtggtgtggtggtggatcgaggaccgttggatctgcgggatcggagaagttctaaggcttggctgcgtgcggtggcgt 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6203944 atagggttttcgagtcggatttgtggtgtggtggtggatcgaggaccgttggatctgcgggatcggagaagttctaaggcttggctgcgtgcggtggcgt 6204043  T
185 cagggcctcgagttggtcttcgcttcctgcttgaaccgtcgtcgtccgccattgctgtctctcactctctctaactaacttc 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6204044 cagggcctcgagttggtcttcgcttcctgcttgaaccgtcgtcgtccgccattgctgtctctcactctctctaactaacttc 6204125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University