View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_47 (Length: 316)
Name: NF1202_low_47
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_47 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 97 - 316
Target Start/End: Complemental strand, 10306907 - 10306687
Alignment:
| Q |
97 |
aaattgatacagctatggttagtattggttcaaggtgtgtgataccagaacaaaatagttg-aagagaggaattacttattaacatgaataacagaaaga |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
10306907 |
aaattgatacagctatggttagtattggttcaaggtgtgtgataccagaacaaaatagttggaagagaggaattacttattgacatgaataaaagaaaga |
10306808 |
T |
|
| Q |
196 |
actgaaacaacataagaaagatacctgaactcttcactttcagatttatcaaaccatatgcaaactattccctatttcccctatttaatggcccctaatc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306807 |
actgaaacaacataagaaagatacctgaactcttcactttcagatttatcaaaccatatgcaaactattccctatttcccctatttaatggcccctaatc |
10306708 |
T |
|
| Q |
296 |
ccctctatcaacctaaagact |
316 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10306707 |
ccctctatcaacctaaagact |
10306687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University