View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_49 (Length: 309)
Name: NF1202_low_49
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 293
Target Start/End: Complemental strand, 10306665 - 10306367
Alignment:
| Q |
1 |
catctatcctaagtcaggatagatacccgaaaataggaactccctgttttattaaatttaaatacaaattcaaactcctaactaacatagttttgtttct |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306665 |
catctatcctaagttaggatagatacccgaaaataggaactccctgttttattatatttaaatacaaattcaaactcctaactaacatagttttgtttct |
10306566 |
T |
 |
| Q |
101 |
ctttcctgacatacaccctacttatatggggtt------tatcagtgtgtgcagtgaaaatacctttggaatttgtgtgtacggtagcagctgactcatt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10306565 |
ctttcctgacatacaccctacttatatggggttgctgcctatcagtgtgtgcagtgaaaatacctttggaatttgtgtgtatggtagcagctgactcatt |
10306466 |
T |
 |
| Q |
195 |
tatatggagtgtggcaatgcacatttaaccttctagactgcaaaatggtgggggcccattcacggggctcccataagatcgagctaggcctgtctatga |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306465 |
tatatggagtgtggcaatgcacatttaaccttctagactgcaaaatggtgggggcccattcacggggctcccataagatcgagctaggcctgtctatga |
10306367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University