View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1202_low_50 (Length: 302)

Name: NF1202_low_50
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1202_low_50
NF1202_low_50
[»] chr1 (1 HSPs)
chr1 (102-220)||(48482474-48482592)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 48482592 - 48482474
Alignment:
102 taaacaaggtacaccaaccaacaaatatgaaaaaagagtaaagagtttgagagaaaatgcagatattaccatgagagctctttcagtttgcattacctca 201  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48482592 taaacaaggtacaccaaccaacaaatatgaaaaaagagtaaggagtttgagagaaaatgcagatattaccatgagagctctttcagtttgcattacctca 48482493  T
202 gacactccatgtggaagct 220  Q
    |||||||||||||||||||    
48482492 gacactccatgtggaagct 48482474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University