View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_54 (Length: 288)
Name: NF1202_low_54
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 3094169 - 3094365
Alignment:
| Q |
1 |
aaatacacaaacatgtcagtttctatgctacttaacatgacagcaaattcaccagtaaatttattgcctaaacacacaaatacttcaatgtctttggaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3094169 |
aaatacacaaacatgtcagtttctatgctacttaacatgacagcaaattcaccagtaaatttattgcctaaacacacaaatacttcaatgtctttggaac |
3094268 |
T |
|
| Q |
101 |
aattttgtagagacactgtgatgactatatggcattatcatggtggttgtcaagttggtagggttgttgatagtgattataaggttgatgatgtcca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
3094269 |
aattttgtagagacactgtgatgactatatggcattatcatggtggttgtcaagttggtagggttgttgatagtgattataaggttgctggtgtcca |
3094365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 10 - 186
Target Start/End: Original strand, 3085332 - 3085508
Alignment:
| Q |
10 |
aacatgtcagtttctatgctacttaacatgacagcaaattcaccagtaaatttattgcctaaacacacaaatacttcaatgtctttggaacaattttgta |
109 |
Q |
| |
|
||||| ||| |||||||| |||||||||||| |||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3085332 |
aacatatcattttctatgttacttaacatgattgcaaatgcacaagtaaatttattgcctaagcacacaaatacttcaatgtctttggaacaattttgta |
3085431 |
T |
|
| Q |
110 |
gagacactgtgatgactatatggcattatcatggtggttgtcaagttggtagggttgttgatagtgattataaggtt |
186 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3085432 |
gagacactgtgatgacaatatggcattatcatggtggttgtcaagttggtagggttgttgataatgattataaggtt |
3085508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 97 - 146
Target Start/End: Complemental strand, 42960094 - 42960045
Alignment:
| Q |
97 |
gaacaattttgtagagacactgtgatgactatatggcattatcatggtgg |
146 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
42960094 |
gaacagttttgtagagacactgtgatcactatttggcactatcatggtgg |
42960045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 404890 - 404934
Alignment:
| Q |
124 |
actatatggcattatcatggtggttgtcaagttggtagggttgtt |
168 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
404890 |
actatatggcattatcatggtggatgtgttgttggtagggttgtt |
404934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University