View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_57 (Length: 285)
Name: NF1202_low_57
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 65 - 254
Target Start/End: Complemental strand, 42090143 - 42089954
Alignment:
| Q |
65 |
aactaaaacattgtaaagcttaatatgacaaggacatgcagtgatgcagccttagttttttgctataaaacaaaatcagtaatcaagtggttttctttaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42090143 |
aactaaaacattgtaaagcttaatatgacaaggacatgcagtgatgcagccttagttttttgctataaaacaaaatcagtaatcaagtggtgttctttaa |
42090044 |
T |
 |
| Q |
165 |
gactaattagtatgattggtaataaatgtaaaaactcactttctttgatttaactccgcaatgggacaatattttgtttgtattaggcga |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42090043 |
gactaattagtatgattggtaataaatgtaaaaactcactttctttgatttaactccacaatgggacaatattttgtttgtattaggcga |
42089954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University