View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_66 (Length: 264)
Name: NF1202_low_66
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 668349 - 668458
Alignment:
| Q |
1 |
acacgtacaagccttcttcaaccaacacaactccttc-catagagatcatattgttcttgatggatactctcttttattcaaacaaactgtgctagcttt |
99 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
668349 |
acacgtacaagccttattcaaccaacacaactccttctcaaagagatcatattgttcttgatggatactctcttttattcaaacaaactgtgctagcttt |
668448 |
T |
 |
| Q |
100 |
atccctatgc |
109 |
Q |
| |
|
|||||||||| |
|
|
| T |
668449 |
atccctatgc |
668458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University