View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_68 (Length: 254)
Name: NF1202_low_68
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_68 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 48 - 254
Target Start/End: Complemental strand, 10252775 - 10252569
Alignment:
| Q |
48 |
tgagtatacatacgcataatgcagcgggaccttaaaatccctaaacatattatgattagaagccataataagtttgagagaagattaacattcatttata |
147 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10252775 |
tgagtatacatacgcataatgcagcggggccttaaaatccctaaacatattatgattagaagccataataagtttgagagaagattaacattcatttata |
10252676 |
T |
|
| Q |
148 |
aaatctaaacattaatggataatcacataaatttataacctacaattctgatacgacatggacgttatgttaacgatcaagaaaactatcaattataagg |
247 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10252675 |
aaatctaaacattcatggataatcacataagtttataacctacaattctgatacgacgtggacgttatgttaacgatcaagaaaactatcaattataagg |
10252576 |
T |
|
| Q |
248 |
attttaa |
254 |
Q |
| |
|
|| |||| |
|
|
| T |
10252575 |
atcttaa |
10252569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 11 - 46
Target Start/End: Complemental strand, 10253526 - 10253491
Alignment:
| Q |
11 |
ttattctatagaagctccatcaagcatccacttctt |
46 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10253526 |
ttattctatggaagctccatcaagcatccacttctt |
10253491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University