View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_70 (Length: 251)
Name: NF1202_low_70
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_70 |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0035 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 75955 - 76196
Alignment:
| Q |
10 |
cacaatatacaaagacttttattagtcgtttggtaccacatgggtcctacataaatgacatggcatagcctactctttgaacattagactccttaggggt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75955 |
cacaaaatacaaagacttttattagtcgtttgataccacatgggtcctacataaatgacatggcatagcctactctttgaacattagactccttaggggt |
76054 |
T |
 |
| Q |
110 |
ccctactttttcttctatataaactacccaacgtgcactcgtctttctcacttcaacctcacaacacataacaaccttcaccttctcttgcaattcaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
76055 |
ccctactttttcttctatataaactacccaacgtgcactcgtctttctcacttcaacctcacaacacaaaacaaccttcaccatctcttgcaattcaatt |
76154 |
T |
 |
| Q |
210 |
agagaaaaacatactctcttcaaccctttcatttcttttctc |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
76155 |
agagagaaacatactctcttcaaccctttcatttcttttctc |
76196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University