View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_72 (Length: 235)
Name: NF1202_low_72
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_72 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 54 - 176
Target Start/End: Complemental strand, 40787616 - 40787494
Alignment:
| Q |
54 |
aaatcaaattccgcttaagtttcagaagtatatgtcacattttgaaaaagaaattcacgattatcaaacatcttttgacgtggaacccagacctttacaa |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40787616 |
aaatcaaattccgcttaagtttcagaagtatatgtcacattttgaaaaagaaattcacgattatcaaacatcttttgacgtggaacccagacctttacag |
40787517 |
T |
 |
| Q |
154 |
gctttgttgttacagaggcaaac |
176 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40787516 |
gctttgttgttacagaggcaaac |
40787494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University