View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_73 (Length: 228)
Name: NF1202_low_73
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_73 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 40393858 - 40393931
Alignment:
| Q |
1 |
gaaaaattgatagaagaaatgtggggagagtgtgagatgcatagtacttattttgtcaaccatagtggtaatgt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40393858 |
gaaaaattgatagaagaaatgtggggagagtgttagatgcatagtacttattttgtcaaccatagtggtaatgt |
40393931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 71
Target Start/End: Original strand, 40385076 - 40385130
Alignment:
| Q |
17 |
aaatgtggggagagtgtgagatgcatagtacttattttgtcaaccatagtggtaa |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
40385076 |
aaatgtggggagagtgtgagatgcatagtacttattttttcaaccactgtggtaa |
40385130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University