View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1202_low_74 (Length: 223)
Name: NF1202_low_74
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1202_low_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 19060646 - 19060780
Alignment:
| Q |
18 |
cacattatttattaccacatgcacttttaatacattaaacacaaatgaaaggtttagatatacactttactccctccgatgaacattttatggaagagga |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
19060646 |
cacattatttattaccgcatgcacttttaatacattaaacacaaatgaaaggtttagatatacactttactccctccaatgaacatttaatggaagagga |
19060745 |
T |
|
| Q |
118 |
acctagcagtagccctgctcttcctctattttatg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19060746 |
acctagcagtagccctgctcttcctctattttatg |
19060780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 18 - 122
Target Start/End: Original strand, 7809962 - 7810066
Alignment:
| Q |
18 |
cacattatttattaccacatgcacttttaatacattaaacacaaatgaaaggtttagatatacactttactccctccgatgaacattttatggaagagga |
117 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||| | |||| | |||||| |||||||| |||| | ||| ||||||||| | || |||||| |
|
|
| T |
7809962 |
cacattatttattaccacgtgcagttttaatacaataaaaataaatatatggtttaaatatacacggtacttcgtcctctgaacatttcacgggagagga |
7810061 |
T |
|
| Q |
118 |
accta |
122 |
Q |
| |
|
||||| |
|
|
| T |
7810062 |
accta |
7810066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 21 - 53
Target Start/End: Original strand, 9625547 - 9625579
Alignment:
| Q |
21 |
attatttattaccacatgcacttttaatacatt |
53 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
9625547 |
attatttattaccccatgcacttttaatacatt |
9625579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University