View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1202_low_77 (Length: 207)

Name: NF1202_low_77
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1202_low_77
NF1202_low_77
[»] chr8 (1 HSPs)
chr8 (1-123)||(27313085-27313207)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 123
Target Start/End: Original strand, 27313085 - 27313207
Alignment:
1 atcaatctggagaaatgcaaatactatgtcagtaattgtaatgatgagtcgctgataaaactaaataattatttttgtgtatgcatcacctggatgatta 100  Q
    |||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27313085 atcaatctggagaaatgcaaataccatgtcagtaattgtaatgaagagtcgctgataaaactaaataattatttttgtgtatgcatcacctggatgatta 27313184  T
101 gattgtctttacaaggccctatg 123  Q
    |||||||||||||||||||||||    
27313185 gattgtctttacaaggccctatg 27313207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University