View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1202_low_79 (Length: 203)

Name: NF1202_low_79
Description: NF1202
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1202_low_79
NF1202_low_79
[»] chr3 (1 HSPs)
chr3 (1-100)||(40193176-40193275)


Alignment Details
Target: chr3 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 40193176 - 40193275
Alignment:
1 tgtcaattagattataaactaatcctatgagataactgataagtattttctttcattggagccagcaatactacttctactgagaatatatatatgctca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40193176 tgtcaattagattataaactaatcctatgagataactgataagtattttctttcattggagccagcaatactacttctactgagaatatatatatgctca 40193275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University