View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12030_high_16 (Length: 277)
Name: NF12030_high_16
Description: NF12030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12030_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 273
Target Start/End: Original strand, 31548818 - 31549081
Alignment:
| Q |
10 |
gatggacatcaggaatggttactatggatcggtagttgaaatctgtctatatcgtcaacaacgactgatgtcagccttatgatcctcctagttgtattgt |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31548818 |
gatggaaatcaggaatggttactatggatcggtagttgaaatctgtctatatcgtcaacaatgactgatgtcagccttatgatcctcctagttgtattgt |
31548917 |
T |
|
| Q |
110 |
ctgagaagacatatatgcatacctcaaaactcaactcattgtctcatttatcttccgttatttttgtcaaatcgacaacgatcaggccaatgtctcagtc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31548918 |
ctgagaagacatatatgcatacctcaaaactcaactcattgtctcatttatcttccgttatttttgtcaaatcgacaacgatgaggccaatgtctcagtc |
31549017 |
T |
|
| Q |
210 |
ataagggcgaataggaccatcgctttctacttttgcagtacggcgtaagtctcagttgatgttt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
31549018 |
ataagggcgaataggaccatcgctttctacttctgcagtacggcgtaagtctcggttgatgttt |
31549081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 72 - 113
Target Start/End: Original strand, 18230262 - 18230303
Alignment:
| Q |
72 |
gactgatgtcagccttatgatcctcctagttgtattgtctga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18230262 |
gactgatgtcagccttatgatcctcctagttgtattgtctga |
18230303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 179 - 222
Target Start/End: Original strand, 18230391 - 18230434
Alignment:
| Q |
179 |
aatcgacaacgatcaggccaatgtctcagtcataagggcgaata |
222 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
18230391 |
aatcgtcaacgatcaggccaatgtctctgtcataaggacgaata |
18230434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University