View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12030_low_11 (Length: 310)
Name: NF12030_low_11
Description: NF12030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12030_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 20 - 303
Target Start/End: Original strand, 2628753 - 2629036
Alignment:
| Q |
20 |
attcggacgtgtgaaataccagaacagaattactattgaatcagacctgaatcgcttccaactctggcaaaatagatatatctggacaatcttcctttgg |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2628753 |
attcggacgtgtgaaataccagcacagaattactattgaatcaaacctgaatcgcttccaactctggcaaaatagatatatctgaacaatcttcctttgg |
2628852 |
T |
 |
| Q |
120 |
cacaccgtcatcatcaaccaactcttcagattttggacccttcatagacttgttataccttgaacgtgcattataaatctgcttgatagtaatcccatcg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628853 |
cacaccgtcatcatcaaccaactcttcagattttggacccttcatagacttgttataccttgaacgtgcattataaatctgcttgatagtaatcccatcg |
2628952 |
T |
 |
| Q |
220 |
tcagctcttcttttcttcaaagtcataagaatattttttggacggacagtgttatttgtcatctcatgaacgagtttcatctct |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628953 |
tcagctcttcttttcttcaaagtcataagaatattttttggacggacagtgttatttgtcatctcatgaacgagtttcatctct |
2629036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University