View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12031_high_13 (Length: 243)
Name: NF12031_high_13
Description: NF12031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12031_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 21 - 198
Target Start/End: Complemental strand, 256672 - 256495
Alignment:
| Q |
21 |
acctacgattattatatatgatataccaaggatccatcccatttgagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttatgata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
256672 |
acctacgattattatatatgatataccaaggatccatcccatttgagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttatgata |
256573 |
T |
|
| Q |
121 |
tgcgcggctgccgtccataatgtccctgtggtttaaaaggaaaccaggtctgagttgagtgtatagatgaacttgcac |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
256572 |
tgcgcggctgcggtccataatgtccctgtggtttaaaaggaaaccaggattgagttgagtgtatagatgaacttgcac |
256495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 227631 - 227726
Alignment:
| Q |
21 |
acctacgattattatatatgatataccaaggatccatcccatttgagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
227631 |
acctacgattattatatatgatataccaaggatccatcccatttgagccatcacccatggcaatgtcagcacaccagcaccaatcactgccgttat |
227726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 200 - 243
Target Start/End: Complemental strand, 256182 - 256139
Alignment:
| Q |
200 |
aatcaagaagaatttaacgaattcatggtgctattgaggaaatt |
243 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
256182 |
aatcaagaagaatttaaggaattcatggtgctattgagaaaatt |
256139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University