View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12031_low_10 (Length: 261)
Name: NF12031_low_10
Description: NF12031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12031_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 24 - 244
Target Start/End: Complemental strand, 38685046 - 38684826
Alignment:
| Q |
24 |
agagggagtttagggtggttggtggttatagtggttccatgacggtttcgggggtgtttccggtggatgagtattgtagagatgcggtggtgatgggatt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38685046 |
agagggagtttagggtggttggtggttatagtggttccatgacggtttcgggggtgtttccggtggatgagtattgtagagatgcggtggtgatgggatt |
38684947 |
T |
|
| Q |
124 |
ggaggatggtttgtggcgtgaggttggagatgtgtggggcgatggggagaatgttagggctgggaagattgttgttggtgatgatgattgtggttctcct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38684946 |
ggaggatggtttgtggcgtgaggttggagatgtgtggggcgatggggagaatgttagggctgggaagattgttgttggtgatgatgattgtggttctcct |
38684847 |
T |
|
| Q |
224 |
ttggttttcatgcttgatgtc |
244 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38684846 |
ttggttttcatgcttgatgtc |
38684826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University