View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12031_low_6 (Length: 351)
Name: NF12031_low_6
Description: NF12031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12031_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 13410393 - 13410061
Alignment:
| Q |
1 |
aagttgagtggaaggtgaaaatgaaggagttgatggtaacatattagaattcatagaaagtgatgaagatgataacaatgaatgtgattgtagtgcagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13410393 |
aagttgagtggaaggtgaaaatgaaggagttgatggtaacatattagaattcatagaaagtgatgaagatgataacaatgaatgtgattgtagtgcagcc |
13410294 |
T |
|
| Q |
101 |
atttgtgaattataataccattgttgaaccaaattagaagcttgtaattgttgttgctgctgcatttgttgtagttgaaaatcaccagagctttgaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13410293 |
atttgtgaattataataccattgttgaaccaaattagaagcttgtaattgttgttgctgctgcatttgttgtagttgaaaatcaccagagctttgaagaa |
13410194 |
T |
|
| Q |
201 |
tatgagaatattccaaatagtctctgatcatgtcagaggttccttgaaccggccgctgcggtgttccagaaggaaccgcggaggccggaaaagactgaag |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
13410193 |
tatgagaatattccaaatagtctctgatcatgtcagaggttccttgaaccggccgctgcggtgttccagaaggaaccgcagtggccggaaaagactgaag |
13410094 |
T |
|
| Q |
301 |
ttgtggttgttgttgcggtggcggcggcataat |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13410093 |
ttgtggttgttgttgcggtggcggcggcataat |
13410061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University