View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12031_low_9 (Length: 295)
Name: NF12031_low_9
Description: NF12031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12031_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 25 - 153
Target Start/End: Original strand, 255942 - 256070
Alignment:
| Q |
25 |
aaagaaagaaggaggctgatacagcagtagttgcaaatgacggtgctcttgtagatgatgatggcaaacccaaacgaacaggtctatagctctttttctt |
124 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
255942 |
aaaggaagaaggaggtggatatagcagtagttgcaaatgacggtgctcttttagatgatgatggcaaacccaaacgaacaggtctatagctctttttctt |
256041 |
T |
|
| Q |
125 |
tctcaaaattttctgcatggtgaattata |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
256042 |
tctcaaaattttctgcatggtgaattata |
256070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 25 - 155
Target Start/End: Complemental strand, 228550 - 228418
Alignment:
| Q |
25 |
aaagaaagaaggaggctgatacagcagtagttgcaaatgacggtgctcttgtagatgatgatggcaaacccaaacgaacaggtct--atagctctttttc |
122 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| | ||| ||||||||| |
|
|
| T |
228550 |
aaaggaagaaggaggtggatatagcagtagttgcaaatgacggtgctcttgtagatgatgatggcaagcccatacgaacaggtatacataactctttttc |
228451 |
T |
|
| Q |
123 |
tttctcaaaattttctgcatggtgaattataat |
155 |
Q |
| |
|
|||| ||||||||| ||| ||||||| |||||| |
|
|
| T |
228450 |
tttcgcaaaattttatgcttggtgaaatataat |
228418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University