View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12032_high_20 (Length: 219)
Name: NF12032_high_20
Description: NF12032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12032_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 78 - 171
Target Start/End: Complemental strand, 38931593 - 38931500
Alignment:
| Q |
78 |
acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaagaacaacacaacttct |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38931593 |
acaaaaactaaagagcattgtcaccatggtgaaaaagaaagaagccatggtgagagaacaagaaccagagaacatgaaggacaacacaacttct |
38931500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University