View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12032_low_12 (Length: 306)
Name: NF12032_low_12
Description: NF12032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12032_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 23 - 286
Target Start/End: Original strand, 45499930 - 45500193
Alignment:
| Q |
23 |
cagcaatcaacaacgtcgcgttggtttactctacgacgagaggatgtgtaagcactacgatccagacgacgatcaccatcccgaaactcccaatcgcatt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45499930 |
cagcaatcaacaacgtcgcgttggtttactctacgacgagaggatgtgtaagcactacgatccagacgacgatcgccatcccgaaactcccaatcgcatt |
45500029 |
T |
 |
| Q |
123 |
agggctatttgggacaagctccaaaccactggcattactgatcggtaatcatcacattagggctttttcttttcctttcttgttttccgtttgttatcag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45500030 |
agggctatttgggacaagctccaaaccactggcattactgatcggtaatcatcacattagggctttttcttttcctttcttgttttccgttttttatcag |
45500129 |
T |
 |
| Q |
223 |
ctatattctgaaactattccgttgttttattgtgtttcagatgtgtacttttggacgctaaaga |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
45500130 |
ctatattctgaaactattccgttgttttatcgtgtttcagatgtctacttttggacgctaaaga |
45500193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University